ID: 1122986112_1122986124

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1122986112 1122986124
Species Human (GRCh38) Human (GRCh38)
Location 14:105212450-105212472 14:105212476-105212498
Sequence CCCTCAAGGAGCTGCCTGGTGCC CCTCACTCAGGGAGGAGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 226} {0: 1, 1: 0, 2: 1, 3: 60, 4: 545}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!