ID: 1122987007_1122987017

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1122987007 1122987017
Species Human (GRCh38) Human (GRCh38)
Location 14:105217148-105217170 14:105217188-105217210
Sequence CCCATCACCTCAGCAGAGACGGC CAGAGCAGGCACAGGGCGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 109} {0: 1, 1: 0, 2: 8, 3: 51, 4: 495}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!