ID: 1122994456_1122994459

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1122994456 1122994459
Species Human (GRCh38) Human (GRCh38)
Location 14:105255362-105255384 14:105255392-105255414
Sequence CCATTTATAAAGACAGCTGGGAG ACCCCAGATGCCACCTGACACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 206} {0: 1, 1: 0, 2: 8, 3: 20, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!