ID: 1122996535_1122996549

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1122996535 1122996549
Species Human (GRCh38) Human (GRCh38)
Location 14:105268333-105268355 14:105268386-105268408
Sequence CCACGCAGCCTCCCTGGGCTGGG CCGGGCCTTGCCAGACTCAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 97, 4: 814} {0: 1, 1: 0, 2: 1, 3: 10, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!