ID: 1123001047_1123001056

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1123001047 1123001056
Species Human (GRCh38) Human (GRCh38)
Location 14:105294238-105294260 14:105294275-105294297
Sequence CCACCACAGTTGGTTGCTGGGCC GAGAGTGTGCCTGGGCTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 120} {0: 1, 1: 0, 2: 4, 3: 66, 4: 537}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!