ID: 1123004559_1123004570

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1123004559 1123004570
Species Human (GRCh38) Human (GRCh38)
Location 14:105314998-105315020 14:105315049-105315071
Sequence CCTGGGAGGTGGACGGCTCCAGC CCGCCGCGCTTTGTTCCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 253} {0: 1, 1: 0, 2: 0, 3: 2, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!