ID: 1123019078_1123019084

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1123019078 1123019084
Species Human (GRCh38) Human (GRCh38)
Location 14:105389198-105389220 14:105389222-105389244
Sequence CCACCCTTGGCATCTTCGTGTGG CGGGCTGTGACCAGACTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 86} {0: 1, 1: 0, 2: 1, 3: 10, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!