ID: 1123023978_1123023987

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1123023978 1123023987
Species Human (GRCh38) Human (GRCh38)
Location 14:105415036-105415058 14:105415054-105415076
Sequence CCACCCGCAGGCCTCCGCAGCGC AGCGCCACGGGCGGCCGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 255} {0: 1, 1: 0, 2: 0, 3: 13, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!