ID: 1123024896_1123024915

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1123024896 1123024915
Species Human (GRCh38) Human (GRCh38)
Location 14:105419934-105419956 14:105419987-105420009
Sequence CCTGCGGCGCCCCCCGCCCCCGC GCCGAGCGCCGCGCCCGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 29, 3: 287, 4: 1836} {0: 1, 1: 0, 2: 1, 3: 32, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!