ID: 1123026729_1123026740

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1123026729 1123026740
Species Human (GRCh38) Human (GRCh38)
Location 14:105428187-105428209 14:105428238-105428260
Sequence CCCCCAGCTCCCAGCAACACTGA TGTCCAGAATGTGGTAGAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 57, 4: 418} {0: 1, 1: 0, 2: 4, 3: 25, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!