ID: 1123026733_1123026740

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1123026733 1123026740
Species Human (GRCh38) Human (GRCh38)
Location 14:105428196-105428218 14:105428238-105428260
Sequence CCCAGCAACACTGACCTATTTTC TGTCCAGAATGTGGTAGAAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 31, 4: 244} {0: 1, 1: 0, 2: 4, 3: 25, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!