ID: 1123026736_1123026742

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1123026736 1123026742
Species Human (GRCh38) Human (GRCh38)
Location 14:105428223-105428245 14:105428255-105428277
Sequence CCTGCCGTTTTGCCTTGTCCAGA AAGTGGAATTGCACAGCATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 450} {0: 1, 1: 0, 2: 5, 3: 39, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!