ID: 1123031525_1123031534

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1123031525 1123031534
Species Human (GRCh38) Human (GRCh38)
Location 14:105454050-105454072 14:105454071-105454093
Sequence CCCTCCCTCCCTCCTGCGCCCAT ATGTCGCCCCACAAGAGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 176, 4: 1991} {0: 1, 1: 0, 2: 0, 3: 5, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!