ID: 1123036908_1123036916

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1123036908 1123036916
Species Human (GRCh38) Human (GRCh38)
Location 14:105475273-105475295 14:105475286-105475308
Sequence CCCCGGGTGCGTCCCGCGCGCTC CCGCGCGCTCCCGTGGGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 55} {0: 1, 1: 0, 2: 0, 3: 8, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!