ID: 1123038913_1123038929

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1123038913 1123038929
Species Human (GRCh38) Human (GRCh38)
Location 14:105482541-105482563 14:105482577-105482599
Sequence CCCGTGTCTCCTGGCCAGGTCCC CCACTCCAACCTGGGCTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 342} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!