ID: 1123042682_1123042693

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1123042682 1123042693
Species Human (GRCh38) Human (GRCh38)
Location 14:105496810-105496832 14:105496854-105496876
Sequence CCTTCTCTGCCACCTGGGTCACT AGGGGGTCCCTGAAGTTACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 85, 4: 1017} {0: 1, 1: 0, 2: 1, 3: 18, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!