ID: 1123043484_1123043489

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1123043484 1123043489
Species Human (GRCh38) Human (GRCh38)
Location 14:105500010-105500032 14:105500030-105500052
Sequence CCGGTGCATGGGACCCAGGAGCA GCACCGGCAAGACCTGGCCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 211} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!