ID: 1123056377_1123056392

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1123056377 1123056392
Species Human (GRCh38) Human (GRCh38)
Location 14:105572545-105572567 14:105572573-105572595
Sequence CCCTCCAGCCCCAGCGAGGGAGG CCCCGGGCAGCAGGTGGTGAGGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 2, 3: 35, 4: 315} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!