ID: 1123057536_1123057554

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1123057536 1123057554
Species Human (GRCh38) Human (GRCh38)
Location 14:105579228-105579250 14:105579262-105579284
Sequence CCGCTGCCCTCACCACCTGCTGC CCTCCCTCGCTGGGGCTGGAGGG
Strand - +
Off-target summary No data {0: 4, 1: 0, 2: 2, 3: 35, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!