ID: 1123115556_1123115561

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1123115556 1123115561
Species Human (GRCh38) Human (GRCh38)
Location 14:105892644-105892666 14:105892657-105892679
Sequence CCTGGGGATACCGGATTCCCATG GATTCCCATGGGGTGATGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 59} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!