ID: 1123121279_1123121295

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1123121279 1123121295
Species Human (GRCh38) Human (GRCh38)
Location 14:105918201-105918223 14:105918249-105918271
Sequence CCCTGGCCCGTGTGTAAGTGGTC ACAAGCGGTGGCAGGAAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 6, 4: 80} {0: 1, 1: 0, 2: 2, 3: 19, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!