ID: 1123139571_1123139584

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1123139571 1123139584
Species Human (GRCh38) Human (GRCh38)
Location 14:106062077-106062099 14:106062101-106062123
Sequence CCCCCTGGTGGTCCCAAGGGACC CTGCAGGGAGGTTTGTGTCTGGG
Strand - +
Off-target summary No data {0: 34, 1: 27, 2: 25, 3: 51, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!