ID: 1123148045_1123148060

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1123148045 1123148060
Species Human (GRCh38) Human (GRCh38)
Location 14:106153509-106153531 14:106153558-106153580
Sequence CCTGCTCCTGGGACCTGTCCCGC GTGGCCCCGCGCGCCCCTGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!