ID: 1123153337_1123153350

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1123153337 1123153350
Species Human (GRCh38) Human (GRCh38)
Location 14:106203071-106203093 14:106203122-106203144
Sequence CCATGGGCTCCTGGGGGCCGAGA CAGGCTCCTCTGTTGCGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 50, 4: 389} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!