ID: 1123162086_1123162097

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1123162086 1123162097
Species Human (GRCh38) Human (GRCh38)
Location 14:106288091-106288113 14:106288136-106288158
Sequence CCCTGTAATCCTGAGGAGGGGGC CCGGGTCCTGTGGACACACACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 19, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!