ID: 1123179007_1123179012

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1123179007 1123179012
Species Human (GRCh38) Human (GRCh38)
Location 14:106450152-106450174 14:106450186-106450208
Sequence CCTGCACGCTCTGGCTGGGACCT ATGAACAGGAGTGGTTAGAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 9, 2: 381, 3: 11905, 4: 7042}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!