ID: 1123208726_1123208739

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1123208726 1123208739
Species Human (GRCh38) Human (GRCh38)
Location 14:106738487-106738509 14:106738540-106738562
Sequence CCAGGGAGCCCCTTCCCTGGAGC GGCGAGTCCAGGAACTGATGGGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 5, 3: 78, 4: 464} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!