ID: 1123208729_1123208738

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1123208729 1123208738
Species Human (GRCh38) Human (GRCh38)
Location 14:106738497-106738519 14:106738539-106738561
Sequence CCTTCCCTGGAGCTCCAGATGCA TGGCGAGTCCAGGAACTGATGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 12, 3: 55, 4: 342} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!