ID: 1123208729_1123208738 |
View in Genome Browser |
Spacer: 19 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1123208729 | 1123208738 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 14:106738497-106738519 | 14:106738539-106738561 |
Sequence | CCTTCCCTGGAGCTCCAGATGCA | TGGCGAGTCCAGGAACTGATGGG |
Strand | - | + |
Off-target summary | {0: 1, 1: 1, 2: 12, 3: 55, 4: 342} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |