ID: 1123210919_1123210924

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1123210919 1123210924
Species Human (GRCh38) Human (GRCh38)
Location 14:106760117-106760139 14:106760162-106760184
Sequence CCCTCGTGGGTGCCTTTGTTACT GGCTGTCACGTGCTGCATGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 7, 4: 75} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!