ID: 1123214073_1123214080

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1123214073 1123214080
Species Human (GRCh38) Human (GRCh38)
Location 14:106790585-106790607 14:106790609-106790631
Sequence CCTGGGACCTGTCCCGTCCTCAG GGTTCCCGACCGCCCCCTGGTGG
Strand - +
Off-target summary {0: 5, 1: 5, 2: 3, 3: 15, 4: 203} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!