ID: 1123215904_1123215907

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1123215904 1123215907
Species Human (GRCh38) Human (GRCh38)
Location 14:106809283-106809305 14:106809312-106809334
Sequence CCTGTCATCACTTCTCTAGGTCA TTGTCCTAGATGAACTTGGTCGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 10, 4: 122} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!