ID: 1123403261_1123403276

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1123403261 1123403276
Species Human (GRCh38) Human (GRCh38)
Location 15:20005956-20005978 15:20005998-20006020
Sequence CCCAAACCTACTGCCAGGTCCGG GGCTGACCTGAGGAGGTAGCAGG
Strand - +
Off-target summary No data {0: 3, 1: 3, 2: 1, 3: 18, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!