ID: 1123434686_1123434687

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1123434686 1123434687
Species Human (GRCh38) Human (GRCh38)
Location 15:20246622-20246644 15:20246645-20246667
Sequence CCAAAGTGCTGGGATTGCAGGCA TGAGCCACCACACCCAGCCAAGG
Strand - +
Off-target summary {0: 1924, 1: 94869, 2: 232667, 3: 241891, 4: 217405} {0: 100, 1: 668, 2: 2148, 3: 4495, 4: 7061}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!