ID: 1123462298_1123462301

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1123462298 1123462301
Species Human (GRCh38) Human (GRCh38)
Location 15:20484160-20484182 15:20484179-20484201
Sequence CCTACGGGGAAATGGGGAGGGGA GGGACATGGACAAAGGCAGCAGG
Strand - +
Off-target summary No data {0: 4, 1: 0, 2: 1, 3: 25, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!