ID: 1123471926_1123471936

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1123471926 1123471936
Species Human (GRCh38) Human (GRCh38)
Location 15:20562149-20562171 15:20562177-20562199
Sequence CCTGCCCCTCTCCCAGAGTTGGC CTCCCCTCTCTTAGAGTGGGTGG
Strand - +
Off-target summary {0: 6, 1: 2, 2: 15, 3: 50, 4: 399} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!