ID: 1123476430_1123476437

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1123476430 1123476437
Species Human (GRCh38) Human (GRCh38)
Location 15:20594921-20594943 15:20594955-20594977
Sequence CCAGTCAGAGAGGCCTCTGATTG CAGCTGACTGGGACCCTCTTGGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 0, 3: 10, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!