ID: 1123493475_1123493479

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1123493475 1123493479
Species Human (GRCh38) Human (GRCh38)
Location 15:20800373-20800395 15:20800386-20800408
Sequence CCCACTCCGCAGCGGCCTGGAAT GGCCTGGAATATGGCACTGCAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 4, 3: 5, 4: 66} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!