ID: 1123493586_1123493592

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1123493586 1123493592
Species Human (GRCh38) Human (GRCh38)
Location 15:20800789-20800811 15:20800825-20800847
Sequence CCTACACTATGGCACGGGAGGAC GCTCTGGACTCCAGCACCGGAGG
Strand - +
Off-target summary No data {0: 11, 1: 0, 2: 0, 3: 27, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!