ID: 1123512599_1123512615

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1123512599 1123512615
Species Human (GRCh38) Human (GRCh38)
Location 15:21012610-21012632 15:21012653-21012675
Sequence CCCAAACCTACTGCCAGGTCCGG GCTGACCTGAGGAGGTAGCAGGG
Strand - +
Off-target summary No data {0: 3, 1: 3, 2: 2, 3: 12, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!