ID: 1123516617_1123516627

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1123516617 1123516627
Species Human (GRCh38) Human (GRCh38)
Location 15:21035369-21035391 15:21035400-21035422
Sequence CCACCCTCCCACCTTGGCCTCCC GCATTTACAGGTGTGTGCCAAGG
Strand - +
Off-target summary No data {0: 2, 1: 2, 2: 30, 3: 144, 4: 2130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!