ID: 1123536440_1123536444

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1123536440 1123536444
Species Human (GRCh38) Human (GRCh38)
Location 15:21189169-21189191 15:21189213-21189235
Sequence CCCTCACCAGGCTTCAAGTTGCT AAATAATTTCAAATATGTTCTGG
Strand - +
Off-target summary {0: 3, 1: 2, 2: 0, 3: 9, 4: 201} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!