ID: 1123539046_1123539052

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1123539046 1123539052
Species Human (GRCh38) Human (GRCh38)
Location 15:21269220-21269242 15:21269235-21269257
Sequence CCTATAATCCCAGCACTTTGTAA CTTTGTAAGGCCCAGGTGGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!