ID: 1123558475_1123558486

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1123558475 1123558486
Species Human (GRCh38) Human (GRCh38)
Location 15:21456533-21456555 15:21456583-21456605
Sequence CCCTCTCTAATCCCAAAGCTCCC TGCAAAAGTATTGTAGCTGTGGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 4, 3: 19, 4: 284} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!