ID: 1123578361_1123578369

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1123578361 1123578369
Species Human (GRCh38) Human (GRCh38)
Location 15:21695038-21695060 15:21695059-21695081
Sequence CCCCCGAGCAGGAGCTGGGCTGA GAGGGAAATCAGCAGGAGGTAGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 3, 3: 43, 4: 424}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!