ID: 1123620741_1123620749

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1123620741 1123620749
Species Human (GRCh38) Human (GRCh38)
Location 15:22184474-22184496 15:22184497-22184519
Sequence CCTCTTAAAATCCCTCACTCCAA ATACAGAGCCACTGGGATTGGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 40, 4: 279} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!