ID: 1123627979_1123627987

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1123627979 1123627987
Species Human (GRCh38) Human (GRCh38)
Location 15:22240560-22240582 15:22240605-22240627
Sequence CCCACAGGAAAAAGAAACAGGAA GGCGCGGATCGCCGCGCCGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 102, 4: 1027} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!