ID: 1123630073_1123630077

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1123630073 1123630077
Species Human (GRCh38) Human (GRCh38)
Location 15:22255052-22255074 15:22255070-22255092
Sequence CCTGTCTCTTGCAGCCTCTGGTA TGGTAGGCCCAGGCACCCCTCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 8, 3: 51, 4: 356} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!