ID: 1123707454_1123707462

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1123707454 1123707462
Species Human (GRCh38) Human (GRCh38)
Location 15:22960276-22960298 15:22960308-22960330
Sequence CCTCACCAGCTTCCTCCACATGC CCTCACAGGTCCCACGCAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 438} {0: 1, 1: 0, 2: 0, 3: 10, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!