ID: 1123716696_1123716701

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1123716696 1123716701
Species Human (GRCh38) Human (GRCh38)
Location 15:23039149-23039171 15:23039167-23039189
Sequence CCAGTTCACGCTTTCCCCGTGAC GTGACGATCAGGACGCGTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 34} {0: 1, 1: 0, 2: 0, 3: 0, 4: 20}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!