ID: 1123718066_1123718074

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1123718066 1123718074
Species Human (GRCh38) Human (GRCh38)
Location 15:23044055-23044077 15:23044089-23044111
Sequence CCTGGCCAGGGGTGCTGGGGGGA CACCTGGCCAGAGGTGCTGGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!